Быстрый заказ

Text Size:AAA

Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ABHD4 Информация о продукте «Клон cDNA»
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Mus musculus abhydrolase domain containing 4 with N terminal His tag.
Синоним гена:Abh4, AI429574, 1110035H23Rik, Abhd4
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50747-ACGRBS15400
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50747-ACRRBS15400
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50747-ANGRBS15400
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50747-ANRRBS15400
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50747-CFRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50747-CHRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50747-CMRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50747-CYRBS13340
Мышь ABHD4 Джин клон кДНК в вектор клонированияMG50747-GRBS5130
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50747-NFRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50747-NHRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50747-NMRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50747-NYRBS13340
Мышь ABHD4 Джин ORF экспрессии кДНК клона плазмидыMG50747-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.

  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
  • Size / Price
    Каталог: MG50747-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.