Быстрый заказ

Text Size:AAA

Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ABHD17A Информация о продукте «Клон cDNA»
Размер кДНК:933bp
Описание кДНК:Full length Clone DNA of Mus musculus abhydrolase domain containing 17A with N terminal Myc tag.
Синоним гена:Fam108a, BC005632, D10Bwg1364e, 1700013O15Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52026-ACGRBS15400
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52026-ACRRBS15400
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52026-CFRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52026-CHRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52026-CMRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52026-CYRBS13340
Мышь ABHD17A Джин клон кДНК в вектор клонированияMG52026-GRBS5130
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52026-NFRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52026-NHRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52026-NMRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52026-NYRBS13340
Мышь ABHD17A Джин ORF экспрессии кДНК клона плазмидыMG52026-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52026-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.