Быстрый заказ

Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь ABCE1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_015751.2
    Размер кДНК:1800bp
    Описание кДНК:Full length Clone DNA of Mus musculus ATP-binding cassette, sub-family E (OABP), member 1 with C terminal His tag.
    Синоним гена:RLI, Oabp, RNS41, C79080, Rnaseli
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG53040-ACGRBS16760
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG53040-ACRRBS16760
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG53040-ANGRBS16760
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG53040-ANRRBS16760
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG53040-CFRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG53040-CHRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG53040-CMRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG53040-CYRBS14710
    Мышь ABCE1 Джин клон кДНК в вектор клонированияMG53040-GRBS5130
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG53040-NFRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG53040-NHRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG53040-NMRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG53040-NYRBS14710
    Мышь ABCE1 Джин ORF экспрессии кДНК клона плазмидыMG53040-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».