Быстрый заказ

Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse A4GALT Информация о продукте «Клон cDNA»
Размер кДНК:1080bp
Описание кДНК:Full length Clone DNA of Mus musculus alpha 1,4-galactosyltransferase with N terminal His tag.
Синоним гена:A4galt
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50733-ACGRBS15400
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50733-ACRRBS15400
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50733-CFRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50733-CHRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50733-CMRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50733-CYRBS13340
Мышь A4GALt / CD77 Джин клон кДНК в вектор клонированияMG50733-GRBS5130
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50733-NFRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50733-NHRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50733-NMRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50733-NYRBS13340
Мышь A4GALt / CD77 Джин ORF экспрессии кДНК клона плазмидыMG50733-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50733-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.