Быстрый заказ

Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse 4921524J17RIK Информация о продукте «Клон cDNA»
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Mus musculus RIKEN cDNA 4921524J17 gene with C terminal His tag.
Синоним гена:4921524J17Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52297-ACGRBS15400
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52297-ACRRBS15400
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52297-ANGRBS15400
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52297-ANRRBS15400
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52297-CFRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52297-CHRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52297-CMRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52297-CYRBS13340
Мышь 4921524J17RIK Джин клон кДНК в вектор клонированияMG52297-GRBS5130
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52297-NFRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52297-NHRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52297-NMRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52297-NYRBS13340
Мышь 4921524J17RIK Джин ORF экспрессии кДНК клона плазмидыMG52297-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52297-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.