2510003E04RIK cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

2510003E04RIK cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1854 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 2510003E04 gene with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

2510003E04RIK cDNA ORF Clone, Mouse, N-His tag: Alternative Names

0710007C18Rik cDNA ORF Clone, Mouse; 2510003E04Rik cDNA ORF Clone, Mouse; KBP cDNA ORF Clone, Mouse; mKIAA1279 cDNA ORF Clone, Mouse

2510003E04RIK Background Information

Full Name
KIF1 binding protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait