Быстрый заказ

Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь 2510003E04RIK Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_028197.2
    Размер кДНК:1854bp
    Описание кДНК:Full length Clone DNA of Mus musculus RIKEN cDNA 2510003E04 gene with N terminal His tag.
    Синоним гена:KBP, mKIAA1279, 0710007C18Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with 2510003E04RIK qPCR primers for gene expression analysis, MP201841 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51968-ACGRBS16760
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51968-ACRRBS16760
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51968-ANGRBS16760
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51968-ANRRBS16760
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51968-CFRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51968-CHRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51968-CMRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51968-CYRBS14710
    Мышь 2510003E04RIK Джин клон кДНК в вектор клонированияMG51968-GRBS5130
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51968-NFRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51968-NHRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51968-NMRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51968-NYRBS14710
    Мышь 2510003E04RIK Джин ORF экспрессии кДНК клона плазмидыMG51968-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51968-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».