1810055G02RIK cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

1810055G02RIK cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 1810055G02 gene.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

1810055G02RIK cDNA ORF Clone, Mouse, untagged: Alternative Names

AI256204 cDNA ORF Clone, Mouse

1810055G02RIK Background Information

Full Name
RIKEN cDNA 1810055G02 gene
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait