Быстрый заказ

Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь 1810055G02RIK Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_028077.2
    Размер кДНК:1179bp
    Описание кДНК:Full length Clone DNA of Mus musculus RIKEN cDNA 1810055G02 gene.
    Синоним гена:AI256204
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with 1810055G02RIK qPCR primers for gene expression analysis, MP202328 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52455-ACGRBS15400
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52455-ACRRBS15400
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52455-CFRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52455-CHRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52455-CMRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52455-CYRBS13340
    Мышь 1810055G02RIK Джин клон кДНК в вектор клонированияMG52455-GRBS5130
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52455-NFRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52455-NHRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52455-NMRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52455-NYRBS13340
    Мышь 1810055G02RIK Джин ORF экспрессии кДНК клона плазмидыMG52455-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52455-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».