Быстрый заказ

Text Size:AAA

Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MMP10 Информация о продукте «Клон cDNA»
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Homo sapiens matrix metallopeptidase 10 (stromelysin 2) with Flag tag.
Синоним гена:MMP10, SL-2, STMY2
Участок рестрикции:KpnI + XhoI (5.4kb + 1.48kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10249-ACGRBS15400
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10249-ACRRBS15400
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10249-CFRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10249-CHRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10249-CMRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10249-CYRBS13340
Человек MMP-10/MMP10 Джин клон кДНК в вектор клонированияHG10249-MRBS5130
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10249-M-FRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10249-NFRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10249-NHRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10249-NMRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10249-NYRBS13340
Человек MMP-10/MMP10 Джин ORF экспрессии кДНК клона плазмидыHG10249-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10249-M-F
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.