After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MIF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:Human
переносчик:
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Склад:
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10246-ACGRBS15396
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10246-ACRRBS15396
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10246-CFRBS13340
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10246-CHRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10246-CMRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10246-CYRBS13343
Человек MIF Джин клон кДНК в вектор клонированияHG10246-MRBS5132
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10246-NFRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10246-NHRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10246-NMRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10246-NYRBS13343
Человек MIF Джин ORF экспрессии кДНК клона плазмидыHG10246-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Macrophage migration inhibitory factor (MIF) is an immunoregulatory cytokine, the effect of which on arresting random immune cell movement was recognized several decades ago. Despite its historic name, MIF also has a direct chemokine-like function and promotes cell recruitment. MIF is an ubiquitously expressed protein that plays a crucial role in many inflammatory and autoimmune disorders. Increasing evidence suggests that MIF also controls metabolic and inflammatory processes underlying the development of metabolic pathologies associated with obesity. Further research has shown that MIF plays a particularly critical part in cell cycle regulation and therefore in tumorigenesis as well. The significance of the role of MIF in a variety of both solid and hematologic tumors has been established. More recently, interest has increased in the role of MIF in the development of central nervous system (CNS) tumors, in which it appears to influence cell cycle control. MIF contributes to malignant disease progression on several different levels. Both circulating and intracellular MIF protein levels are elevated in cancer patients and MIF expression reportedly correlates with stage, metastatic spread and disease-free survival. Blockade of MIF bioactivity successfully inhibited tumor cell growth in vivo and in vitro. MIF plays important roles in the pathogenesis of gastrointestinal, hepatic, and pancreatic disorders.

Ссылки
  • Ohkawara T, et al. (2005) Pathophysiological roles of macrophage migration inhibitory factor in gastrointestinal, hepatic, and pancreatic disorders. J Gastroenterol. 40(2): 117-22.
  • Bach JP, et al.. (2009) The role of macrophage inhibitory factor in tumorigenesis and central nervous system tumors. Cancer. 115(10): 2031-40.
  • Rendon BE, et al.. (2009) Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol. 86(3): 180-5.
  • Grieb G, et al. (2010) Macrophage migration inhibitory factor (MIF): a promising biomarker. Drug News Perspect. 23(4): 257-64.
  • Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».