Быстрый заказ

Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек METAP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_006838.3
    Размер кДНК:1437bp
    Описание кДНК:Full length Clone DNA of Homo sapiens methionyl aminopeptidase 2 with Flag tag.
    Синоним гена:METAP2, p67, MAP2, MNPEP, p67eIF2
    Виды:Human
    переносчик:pCMV2-FLAG
    Plasmid:pCMV2-METAP2-flag
    Участок рестрикции:KpnI + XhoI (5.4kb + 1.49kb)
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with METAP2 qPCR primers for gene expression analysis, HP100295 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV2-FLAG Vector Information
     
    Vector Name pCMV2-FLAG
    Vector Size 5592bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive, Stable / Transient
    Promoter CMV
    Antibiotic Resistance Kanamycin
    Selection In Mammalian Cells Hygromycin
    Protein Tag FLAG
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)

    Schematic of pCMV2-FLAG Multiple Cloning Sites

    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10245-ACGRBS15400
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10245-ACRRBS15400
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10245-ANGRBS15400
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10245-ANRRBS15400
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10245-CFRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10245-CHRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10245-CMRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10245-CYRBS13340
    Человек MAP2 Джин клон кДНК в вектор клонированияHG10245-MRBS5130
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10245-NFRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10245-NHRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10245-NMRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10245-NYRBS13340
    Человек MAP2 Джин ORF экспрессии кДНК клона плазмидыHG10245-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

    Ссылки
  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».