After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
MERS-CoV CoV-orf5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:JX869059.2
Размер кДНК:324bp
Описание кДНК:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf5 with N terminal His tag.
Синоним гена:CoV-orf5
Виды:MERS-CoV
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank AFS88940 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His Метка on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-GFPSpark МеткаVG40086-ACGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40086-ACRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-GFPSpark МеткаVG40086-ANGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40086-ANRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Flag МеткаVG40086-CFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-His МеткаVG40086-CHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Myc МеткаVG40086-CMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA МеткаVG40086-CYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid (Codon Optimized)VG40086-GRBS6500
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Flag МеткаVG40086-NFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His МеткаVG40086-NHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Myc МеткаVG40086-NMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-HA МеткаVG40086-NYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 natural ORF mammalian expression plasmidVG40086-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40086-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».