Быстрый заказ

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
MERS-CoV CoV-orf5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:JX869059.2
Размер кДНК:324bp
Описание кДНК:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf5 with C terminal HA tag.
Синоним гена:CoV-orf5
Виды:MERS-CoV
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank AFS88940 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA Метка on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-GFPSpark МеткаVG40086-ACGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40086-ACRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-GFPSpark МеткаVG40086-ANGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40086-ANRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Flag МеткаVG40086-CFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-His МеткаVG40086-CHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-Myc МеткаVG40086-CMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, C-HA МеткаVG40086-CYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid (Codon Optimized)VG40086-GRBS6500
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Flag МеткаVG40086-NFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-His МеткаVG40086-NHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-Myc МеткаVG40086-NMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 ORF mammalian expression plasmid, N-HA МеткаVG40086-NYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf5 natural ORF mammalian expression plasmidVG40086-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40086-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».