After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
MERS-CoV CoV-orf4b Информация о продукте «Клон cDNA»
Gene_bank_ref_id:JX869059.2
Размер кДНК:741bp
Описание кДНК:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with C terminal HA tag.
Синоним гена:CoV-orf4b
Виды:MERS-CoV
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank AFS88939.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA Метка on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-GFPSpark МеткаVG40084-ACGRBS22238
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40084-ACRRBS22238
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-GFPSpark МеткаVG40084-ANGRBS22238
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-OFPSpark / RFP МеткаVG40084-ANRRBS22238
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Flag МеткаVG40084-CFRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-His МеткаVG40084-CHRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-Myc МеткаVG40084-CMRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA МеткаVG40084-CYRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid (Codon Optimized)VG40084-GRBS6500
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Flag МеткаVG40084-NFRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His МеткаVG40084-NHRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-Myc МеткаVG40084-NMRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-HA МеткаVG40084-NYRBS20185
MERS-CoV (NCoV / Novel coronavirus) orf4b natural ORF mammalian expression plasmidVG40084-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40084-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».