Быстрый заказ

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA tag

ПаспортОбзорыСвязанные продуктыПротоколы
MERS-CoV CoV-orf4a Информация о продукте «Клон cDNA»
Gene_bank_ref_id:JX869059.2
Размер кДНК:330bp
Описание кДНК:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4a with C terminal HA tag.
Синоним гена:CoV-orf4a
Виды:MERS-CoV
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank AFS88938 sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA tag on other vectors
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-GFPSpark tagVG40083-ACGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40083-ACRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-GFPSpark tagVG40083-ANGRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40083-ANRRBS22240
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Flag tagVG40083-CFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-His tagVG40083-CHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-Myc tagVG40083-CMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, C-HA tagVG40083-CYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid (Codon Optimized)VG40083-GRBS6500
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Flag tagVG40083-NFRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-His tagVG40083-NHRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-Myc tagVG40083-NMRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a ORF mammalian expression plasmid, N-HA tagVG40083-NYRBS20190
MERS-CoV (NCoV / Novel coronavirus) orf4a natural ORF mammalian expression plasmidVG40083-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40083-CY
Цена по прейскуранту:   (Save )
Цена:      [How to order]
Наличие
 Инструкции по доставке
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».