Быстрый заказ

MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
MERS-CoV CoV-M Информация о продукте «Клон cDNA»
Размер кДНК:660bp
Описание кДНК:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) M with C terminal HA tag.
Синоним гена:CoV-M
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank AFS88942 sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-HA Метка on other vectors
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-GFPSpark МеткаVG40085-ACGRBS22240
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40085-ACRRBS22240
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-GFPSpark tagVG40085-ANGRBS22240
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-OFPspark tagVG40085-ANRRBS22240
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-Flag МеткаVG40085-CFRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-His МеткаVG40085-CHRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-Myc МеткаVG40085-CMRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, C-HA МеткаVG40085-CYRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid (Codon Optimized)VG40085-GRBS6500
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-Flag МеткаVG40085-NFRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-His МеткаVG40085-NHRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-Myc МеткаVG40085-NMRBS20190
MERS-CoV (NCoV / Novel coronavirus) M ORF mammalian expression plasmid, N-HA МеткаVG40085-NYRBS20190
MERS-CoV (NCoV / Novel coronavirus) M natural ORF mammalian expression plasmidVG40085-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40085-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.