After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LYVE1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006691.3
Размер кДНК:969bp
Описание кДНК:Full length Clone DNA of Homo sapiens lymphatic vessel endothelial hyaluronan receptor 1 with Flag tag.
Синоним гена:HAR, XLKD1, LYVE-1, CRSBP-1
Виды:Human
переносчик:pCMV2-FLAG
Plasmid:pCMV2-LYVE1-flag
Участок рестрикции:KpnI + XhoI (5.4kb + 1.02kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10237-ACGRBS15400
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10237-ACRRBS15400
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10237-CFRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10237-CHRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10237-CMRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10237-CYRBS13340
Человек LYVE1 / LYVE-1 Джин клон кДНК в вектор клонированияHG10237-MRBS5130
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10237-M-FRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10237-NFRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10237-NHRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10237-NMRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10237-NYRBS13340
Человек LYVE1 / LYVE-1 Джин ORF экспрессии кДНК клона плазмидыHG10237-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LYVE1, also known as LYVE-1, is a type I integral membrane glycoprotein. It contains 1 Link domain and mainly expressed in endothelial cells lining lymphatic vessels. LYVE1 acts as a receptor and binds to both soluble and immobilized hyaluronan. It may function in lymphatic hyaluronan transport and have a role in tumor metastasis. LYVE1 also is a cell surface receptor on lymphatic endothelial cells that can be used as a lymphatic endothelial cell marker, and sort these cells for experimental purposes. It also functions as a ligand-specific transporter trafficking between intracellular organelles and the plasma membrane. It plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding. It may act as an hyaluronan transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.

Ссылки
  • Jackson DG. (2003) The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med. 13(1):1-7.
  • Banerji S, et al. (1999) LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol. 144(4):789-801.
  • Mouta Carreira C, et al. (2001) LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis. Cancer Res. 61(22): 8079-84.
  • Cursiefen C, et al. (2002) Lymphatic vessels in vascularized human corneas: immunohistochemical investigation using LYVE-1 and podoplanin. Invest Ophthalmol Vis Sci. 43(7):2127-35.
  • Size / Price
    Каталог: HG10237-M-F
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».