Быстрый заказ

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь KDR/VEGFR2/CD309 Информация о продукте «Клон cDNA»
Размер кДНК:
Описание кДНК:
Синоним гена:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Мышь KDR/VEGFR2/CD309 Gene Plasmid Map
Mouse KDR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50998-ACGRBS25660
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50998-ACRRBS25660
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50998-CFRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50998-CHRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50998-CMRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50998-CYRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин клон кДНК в вектор клонированияMG50998-GRBS5130
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50998-NFRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50998-NHRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50998-NMRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50998-NYRBS23610
Мышь VEGFR2/KDR/Flk-1/CD309 Джин ORF экспрессии кДНК клона плазмидыMG50998-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.
  • Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.