Быстрый заказ

Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Influenza B HA Информация о продукте «Клон cDNA»
Размер кДНК:1758bp
Описание кДНК:Full length Clone DNA of Influenza B (B/Malaysia/2506/2004) HA with N terminal His tag.
Синоним гена:HA1, Hemagglutinin
Виды:Influenza B
Участок рестрикции:KpnI + XbaI (6kb + 1.80kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACO05957.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza B HA Gene Plasmid Map
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Грипп B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11716-ACGRBS23610
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG11716-ACRRBS23610
Грипп B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-CRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin natural ORF mammalian expression plasmid, HA МеткаVG11716-C-YRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG11716-CFRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG11716-CHRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG11716-CMRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG11716-CYRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG11716-NFRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG11716-NHRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11716-NMRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG11716-NYRBS21550
Грипп B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG11716-NH
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.