Быстрый заказ

Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H8N4 HA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1701bp
Описание кДНК:Full length Clone DNA of Influenza A H8N4 (A/pintail duck/Alberta/114/1979) HA with N terminal His tag.
Синоним гена:HA1, Hemagglutinin
Виды:H8N4
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB87729.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11722-ACGRBS23610
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG11722-ACRRBS23610
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11722-CRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG11722-CFRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG11722-CHRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG11722-CMRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG11722-CYRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG11722-NFRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG11722-NHRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11722-NMRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG11722-NYRBS21550
Грипп А H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11722-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG11722-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».