After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H6N1 HA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1701bp
Описание кДНК:Full length Clone DNA of Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) HA with N terminal His tag.
Синоним гена:HA1, Hemagglutinin
Виды:H6N1
переносчик:pCMV3-SP-N-His
Plasmid:pCMV3-His-H6N1-NC-07-HA
Участок рестрикции:KpnI + XbaI (6kb + 1.75kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACE81692.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
H6N1 HA Gene Plasmid Map
Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11723-ACGRBS23610
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG11723-ACRRBS23610
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11723-CRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG11723-CFRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG11723-CHRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG11723-CMRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG11723-CYRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG11723-NFRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG11723-NHRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11723-NMRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG11723-NYRBS21550
Грипп А H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11723-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Ссылки
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Каталог: VG11723-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Influenza A H6N1 (A/northern shoveler/California/HKWF115/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».