Быстрый заказ

Text Size:AAA

Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H5N1 NA Информация о продукте «Клон cDNA»
Размер кДНК:1350bp
Описание кДНК:Full length Clone DNA of Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase with C terminal HA tag.
Синоним гена:Neuraminidase, NA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFF60789.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка on other vectors
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40064-ACGRBS22238
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40064-ACRRBS22238
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized)VG40064-CRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40064-CFRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40064-CHRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40064-CMRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40064-CYRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40064-NFRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40064-NHRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40064-NMRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40064-NYRBS20185
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized)VG40064-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
Каталог: VG40064-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.