After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H5N1 HA Информация о продукте «Клон cDNA»
Размер кДНК:1707bp
Описание кДНК:Full length Clone DNA of Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin with C terminal HA tag.
Синоним гена:Hemagglutinin, HA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFF60787.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка on other vectors
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40065-ACGRBS23607
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40065-ACRRBS23607
Грипп А H5N1 (A/Thailand/1(KAN-1)/2004) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40065-CRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40065-CFRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40065-CHRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40065-CMRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40065-CYRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40065-NFRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40065-NHRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40065-NMRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40065-NYRBS21554
Грипп А H5N1 (Thailand/1(KAN-1)/2004) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40065-UTRBS21554
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40065-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.