Быстрый заказ

Text Size:AAA

Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H5N1 HA Информация о продукте «Клон cDNA»
Размер кДНК:1707bp
Описание кДНК:Full length Clone DNA of Influenza A H5N1 (A/Cambodia/S1211394/2008) Hemagglutinin with N terminal His tag.
Синоним гена:Hemagglutinin, HA
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADM95445.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Грипп А H5N1 (A/Cambodia/S1211394/2008) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40026-ACGRBS23610
Грипп А H5N1 (A/Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40026-ACRRBS23610
Грипп А H5N1 (A/Cambodia/S1211394/2008) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40026-CRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40026-CFRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40026-CHRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40026-CMRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40026-CYRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40026-NFRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40026-NHRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40026-NMRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40026-NYRBS21550
Грипп А H5N1 (Cambodia/S1211394/2008) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40026-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40026-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.