Быстрый заказ

Text Size:AAA

Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Метка, expression ready

ПаспортОбзорыСвязанные продуктыПротоколы
H5N1 HA Информация о продукте «Клон cDNA»
Размер кДНК:1725bp
Описание кДНК:Full length Clone DNA of Influenza A H5N1 (A/Duck/Hong Kong/p46/97) HA with N terminal His tag.
Синоним гена:HA1, Hemagglutinin
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAF02306.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Метка, expression ready on other vectors
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark Метка, expression readyVG40001-ACGRBS23607
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40001-ACRRBS23607
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-CRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag Метка, expression readyVG40001-CFRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His Метка, expression readyVG40001-CHRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc Метка, expression readyVG40001-CMRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA Метка, expression readyVG40001-CYRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag МеткаVG40001-NFRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His Метка, expression readyVG40001-NHRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc Метка, expression readyVG40001-NMRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA Метка, expression readyVG40001-NYRBS21554
Грипп А H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UTRBS21554
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40001-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.