Быстрый заказ

Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H4N8 HA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1695bp
Описание кДНК:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin with C terminal HA tag.
Синоним гена:Hemagglutinin, HA
Виды:H4N8
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка on other vectors
Грипп А H4N8 (A/chicken/Alabama/1/1975) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACGRBS23610
Грипп А H4N8 (A/chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40025-ACRRBS23610
Грипп А H4N8 (A/chicken/Alabama/1/1975) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-CRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40025-CFRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40025-CHRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40025-CMRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40025-CYRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40025-NFRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40025-NHRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NMRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40025-NYRBS21550
Грипп А H4N8 (chicken/Alabama/1/1975) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40025-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40025-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».