Быстрый заказ

Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H4N6 NA Информация о продукте «Клон cDNA»
Размер кДНК:1413bp
Описание кДНК:Full length Clone DNA of Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase with C terminal HA tag.
Синоним гена:Neuraminidase, NA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-HA Метка on other vectors
Грипп А H4N6 (A/mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-GFPSpark МеткаVG40235-ACGRBS22240
Грипп А H4N6 (A/mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40235-ACRRBS22240
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-Flag МеткаVG40235-CFRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-His МеткаVG40235-CHRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-Myc МеткаVG40235-CMRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, C-HA МеткаVG40235-CYRBS20190
Грипп А H4N6 (A/mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid (Codon Optimized)VG40235-GRBS6500
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, N-Flag МеткаVG40235-NFRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, N-His МеткаVG40235-NHRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, N-Myc МеткаVG40235-NMRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) ORF mammalian expression plasmid, N-HA МеткаVG40235-NYRBS20190
Грипп А H4N6 (mallard/Ohio/657/2002) Нейраминидаза (NA) natural ORF mammalian expression plasmidVG40235-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Size / Price
    Каталог: VG40235-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.