After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H3N2 HA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1701bp
Описание кДНК:Full length Clone DNA of Influenza A virus H3N2 (A/Hong Kong/1/1968) Hemagglutinin with C terminal HA tag.
Синоним гена:HA
Виды:H3N2
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with Q91MA7.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка on other vectors
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40116-ACGRBS23610
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40116-ACRRBS23610
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG40116-CRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40116-CFRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40116-CHRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40116-CMRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40116-CYRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40116-NFRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40116-NHRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40116-NMRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40116-NYRBS21550
Грипп А H3N2 (A/Hong Kong/1/1968) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG40116-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

Ссылки
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».