After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
H1N1 HA Информация о продукте «Клон cDNA»
Размер кДНК:1701bp
Описание кДНК:Full length Clone DNA of Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin with N terminal His tag.
Синоним гена:Hemagglutinin, HA
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACQ63286.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Грипп А H1N1 (A/Ohio/07/2009) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40007-ACGRBS23610
Грипп А H1N1 (A/Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40007-ACRRBS23610
Грипп А H1N1 (A/Ohio/07/2009) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40007-CRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40007-CFRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40007-CHRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40007-CMRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40007-CYRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40007-NFRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40007-NHRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40007-NMRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40007-NYRBS21550
Грипп А H1N1 (Ohio/07/2009) Гемагглютинин(HA) ORF mammalian expression plasmid (Codon Optimized)VG40007-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG40007-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.