Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag

Price:
Size:
Number:

Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag: General Information

Gene
Species
H13N8
RefSeq ORF Size
1698 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAV91212.1.
Description
Full length Clone DNA of Influenza A H13N8 (A/black-headed gull/Netherlands/1/00) HA with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hemagglutinin / HA Background Information

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.
Full Name
Harvey rat sarcoma viral oncogene homolog
References
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). ""Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin"". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). ""Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses"". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). ""Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential"". Avian Dis. 40 (2): 425–37

Hemagglutinin / HA cDNA ORF Clone, H5N1, Related Products

Hemagglutinin / HA cDNA ORF Clone, H1N1, Related Products

Hemagglutinin / HA cDNA ORF Clone, H3N2, Related Products

Hemagglutinin / HA cDNA ORF Clone, Influenza B, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait