Быстрый заказ

Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
H12N5 HA Информация о продукте «Клон cDNA»
Размер кДНК:1695bp
Описание кДНК:Full length Clone DNA of Influenza A H12N5 (A/green-winged teal/ALB/199/1991) HA with N terminal His tag.
Синоним гена:HA1, Hemagglutinin
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB88110.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11718-ACGRBS23610
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11718-ACRRBS23610
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-CRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11718-CFRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11718-CHRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11718-CMRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11718-CYRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11718-NFRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11718-NHRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11718-NMRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11718-NYRBS21550
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: VG11718-NH
Цена по прейскуранту:   (Save )
Цена:      [How to order]
Наличие2-3 weeksИнструкции по доставке
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.