Быстрый заказ

ПаспортОбзорыСвязанные продуктыПротоколы
Человек IL6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:
Описание кДНК:
Синоним гена:
Виды:
переносчик:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Shipping_carrier:
Склад:
Человек IL6 Gene Plasmid Map
Human IL6 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10395-ACGRBS15400
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10395-ACRRBS15400
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10395-CFRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10395-CHRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10395-CMRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10395-CYRBS13340
Человек IL6/IL-6/Interleukin-6 Джин клон кДНК в вектор клонированияHG10395-MRBS5130
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10395-NFRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10395-NHRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10395-NMRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10395-NYRBS13340
Человек IL6/IL-6/Interleukin-6 Джин ORF экспрессии кДНК клона плазмидыHG10395-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».