After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL2RB/CD122 Информация о продукте «Клон cDNA»
Размер кДНК:1656bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 2 receptor, beta.
Синоним гена:IL2RB, CD122, P70-75
Участок рестрикции:KpnI + XbaI (5.5kb + 1.66kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IL2RB/CD122 Gene Plasmid Map
Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10696-ACGRBS16760
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10696-ACRRBS16760
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10696-CFRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10696-CHRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10696-CMRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10696-CYRBS14710
Человек CD122 / IL-2RB Джин клон кДНК в вектор клонированияHG10696-MRBS5130
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10696-NFRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10696-NHRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10696-NMRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10696-NYRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмидыHG10696-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Каталог: HG10696-M-N
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.