Быстрый заказ

Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды

  • Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Человек IL2RB/CD122 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000878.2
Размер кДНК:1656bp
Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 2 receptor, beta.
Синоним гена:IL2RB, CD122, P70-75
Виды:Human
переносчик:pCMV/hygro
Plasmid:pCMV-IL2RB
Участок рестрикции:KpnI + XbaI (5.5kb + 1.66kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL2RB qPCR primers for gene expression analysis, HP100651 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек IL2RB/CD122 Gene Plasmid Map
Human IL2Rb / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10696-ACGRBS16760
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10696-ACRRBS16760
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10696-CFRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10696-CHRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10696-CMRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10696-CYRBS14710
Человек CD122 / IL-2RB Джин клон кДНК в вектор клонированияHG10696-MRBS5130
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10696-NFRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10696-NHRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10696-NMRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10696-NYRBS14710
Человек CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмидыHG10696-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

Ссылки
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Каталог: HG10696-M-N
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».