After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse IL2RB/CD122 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008368.3
Размер кДНК:1620bp
Описание кДНК:Full length Clone DNA of Mus musculus interleukin 2 receptor, beta chain with Flag tag.
Синоним гена:p70, CD122, IL15Rbeta, Il-2Rbeta, MGC118674, IL-15Rbeta, Il-2/15Rbeta
Виды:Mouse
переносчик:pCMV/hygro-FLAG
Plasmid:pCMV-mIL2RB-flag
Участок рестрикции:HindIII + XhoI (5.5kb + 1.65kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL2RB/CD122 Gene Plasmid Map
Mouse IL2RB / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50792-ACGRBS16760
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50792-ACRRBS16760
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50792-CFRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50792-CHRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50792-CMRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50792-CYRBS14710
Мышь CD122 / IL-2RB Джин клон кДНК в вектор клонированияMG50792-GRBS5130
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50792-NFRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50792-NHRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50792-NMRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50792-NYRBS14710
Мышь CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмидыMG50792-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

Ссылки
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Contact Us
    Изображения
    • Mouse IL2RB / CD122 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».