IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
792 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 22 receptor, alpha 2 transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 0.84kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-22BP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

IL-22BP cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CRF2-10 cDNA ORF Clone, Human; CRF2-S1 cDNA ORF Clone, Human; CRF2X cDNA ORF Clone, Human; IL-22BP cDNA ORF Clone, Human; IL-22R-alpha-2 cDNA ORF Clone, Human; IL-22RA2 cDNA ORF Clone, Human; ZCYTOR16 cDNA ORF Clone, Human

IL-22BP Background Information

Interleukin-22 receptor subunit alpha-2 (IL-22RA2), also known as interleukin-22-binding protein (IL-22BP), is a subunit of the receptor for interleukin 22. IL-22BP belongs to the type I I cytokine receptor family and contains 3 fibronectin type-III domains. IL-22BP/IL-22RA2 is expressed in a range of tissues, including those in the digestive, female reproductive, and immune systems. It is expressed in placenta, spleen, breast, skin and lung. It is also detected in intestinal tract, testis, brain, heart and thymus. The dominant cell types expressing IL-22BP/IL-22RA2 were mononuclear cells and epithelium. IL-22BP/IL-22RA2 may play an important role as an IL-22 antagonist in the regulation of inflammatory responses. Interleukin-22 (IL-22) is a member of IL-1 family. It is produced by T cells and induces the production of acute-phase reactants. IL-22 plays important roles in immune response through activation of the STAT 3 signal transduction pathway. Two types of IL-22-binding receptor have been discovered, a membrane-bound receptor and a soluble receptor.
Full Name
interleukin 22 receptor, alpha 2
References
  • Whittington HA, et al. (2004) Interleukin-22: a potential immunomodulatory molecule in the lung. Am J Respir Cell Mol Biol. 31(2): 220-6.
  • Dumoutier L, et al. (2001) Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J Immunol. 166(12): 7090-5.
  • Wei CC, et al. (2003) Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4(3): 204-11.

IL-22BP cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed