After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PLAT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000930.3
Размер кДНК:1689bp
Описание кДНК:Full length Clone DNA of Homo sapiens plasminogen activator, tissue (PLAT), transcript variant 1 with N terminal Myc tag.
Синоним гена:PLAT, TPA, T-PA, DKFZp686I03148
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10157-ACGRBS16760
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10157-ACRRBS16760
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10157-CFRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10157-CHRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10157-CMRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10157-CYRBS14710
Человек tPA transcript variant 1 Джин клон кДНК в вектор клонированияHG10157-MRBS5130
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10157-M-FRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10157-NFRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10157-NHRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10157-NMRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10157-NYRBS14710
Человек tPA transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10157-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tissue plasminogen activator (abbreviated tPA or PLAT), is traditionally viewed as a simple serine protease whose main function is to convert plasminogen into biologically active plasmin. As a protease, tPA plays a crucial role in regulating blood fibrinolysis, in maintaining the homeostasis of extracellular matrix and in modulating the post-translational activation of growth factors. tPA is synthesized and secreted as a single chain polypeptide precursor which is cleaved in turn by plasmin. Proteolytic cleavage at the C-terminal side of Arg275 generates the enzyme composed of two subunits, designated as α and β chains which are held together by a single disulfide bond. Unlike the other members of the chymotrypsin family, tPA has one particular distinction in that the catalytic efficiency of the single-chain enzyme is only slightly lower than that of the proteolytically cleaved form and is therefore not a true zymogen. tPA is found not only in the blood, where its primary function is as a thrombolytic enzyme, but also in the central nervous system (CNS). It participats in a number of physiological and pathological events in the CNS, as well as the role of neuroserpin as the natural regulator of tPA's activity in these processes. Increased or decreased activity of tPA leads to hyperfibrinolysis or hypofibrinolysis, respectively. In addition, as a cytokine, tPA plays a pivotal role in the pathogenesis of renal interstitial fibrosis through diverse mechanisms. Thus, as a fibrogenic cytokine, it promotes the progression of kidney diseases.

Ссылки
  • Yepes M, et al. (2004) New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp Biol Med (Maywood). 229(11): 1097-104.
  • Samson AL, et al. (2006) Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron. 50(5): 673-8.
  • Skrzypiec AE, et al. (2008) Tissue plasminogen activator in the amygdala: a new role for an old protease. J Physiol Pharmacol. 59 Suppl 8: 135-46.
  • Hu K, et al. (2008) Novel actions of tissue-type plasminogen activator in chronic kidney disease. Front Biosci. 13: 5174-86.
  • Size / Price
    Каталог: HG10157-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».