After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
RSV RSV-F Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1725bp
Описание кДНК:Full length Clone DNA of Human RSV (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F with N terminal His tag.
Синоним гена:F, HRSVgp08
Виды:RSV
переносчик:pCMV3-SP-N-His
Plasmid:pCMV3-His-RSV-F(A-RSS2)
Участок рестрикции:KpnI + XbaI (6kb + 1.74kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P11209.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
RSV RSV-F Gene Plasmid Map
Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His Метка on other vectors
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40037-ACGRBS23610
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40037-ACRRBS23610
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40037-CFRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40037-CHRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40037-CMRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40037-CYRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-GRBS7870
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40037-NFRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40037-NHRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40037-NMRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40037-NYRBS21550
Человек respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40037-UTRBS21550
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

Ссылки
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Каталог: VG40037-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human respiratory syncytial virus (RSV) (subtype A, strain RSS-2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tag
    • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».