Быстрый заказ

Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    RSV RSV-G Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:
    Размер кДНК:897bp
    Описание кДНК:Full length Clone DNA of Human RSV (subtype A, strain A2) glycoprotein G / RSV-G with C terminal HA tag.
    Синоним гена:G, HRSVgp07
    Виды:RSV
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03423.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA Метка on other vectors
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40038-ACGRBS22240
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP МеткаVG40038-ACRRBS22240
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-GFPSpark tagVG40038-ANGRBS22240
    Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark tagVG40038-ANRRBS22240
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), C-Flag МеткаVG40038-CFRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-His МеткаVG40038-CHRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-Myc МеткаVG40038-CMRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, C-HA МеткаVG40038-CYRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-GRBS6500
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-Flag МеткаVG40038-NFRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-His МеткаVG40038-NHRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40038-NMRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G (Codon Optimized) ORF mammalian expression plasmid, N-HA МеткаVG40038-NYRBS20190
    Человек respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G ORF mammalian expression plasmid (Codon Optimized)VG40038-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

    Ссылки
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».