PXN cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

PXN cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1674 bp
Description
Full length Clone DNA of Human paxillin, transcript variant 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PXN Background Information

PXN was significantly upregulated in cervical cancer, which associated with tumor stage, poor differentiation, lymphovascular space invasion and lymphatic metastasis. Knockdown of PXN notably impaired cellular growth and colony formation by suppressing Bcl-2 and inducing marked apoptosis. Moreover, PXN led to resistance to radiation, and downregulation of PXN resensitized C33A cells to radiation.PXN was frequently upregulated and acted as an oncogene via regulating Bcl-2 in cervical cancer, which supports PXN as a potent therapeutic target.
Full Name
paxillin
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait