Быстрый заказ

Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human NRG1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013957.3
Размер кДНК:1914bp
Описание кДНК:Full length Clone DNA of Homo sapiens neuregulin 1 transcript variant HRG-beta2.
Синоним гена:GGF, HGL, HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10658-ACGRBS16760
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10658-ACRRBS16760
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10658-CFRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10658-CHRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10658-CMRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10658-CYRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин клон кДНК в вектор клонированияHG10658-MRBS5130
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10658-NFRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10658-NHRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10658-NMRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10658-NYRBS14710
Человек NRG1/Neuregulin 1 transcript variant HRG-beta2 Джин ORF экспрессии кДНК клона плазмидыHG10658-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family of receptors. This growth factor was originally identified as a 44-kD glycoprotein that interacts with the NEU / ERBB2 receptor tyrosine kinase to increase its phosphorylation on tyrosine residues. NRG1 is a trophic factor that has been implicated in neural development, neurotransmission, and synaptic plasticity. NRG1 has multiple isoforms that are generated by usage of different promoters and alternative splicing of a single gene. Neuregulin 1 (NRG1) is essential for the development and function of multiple organ systems, and its dysregulation has been linked to diseases such as cancer and schizophrenia. NRG1 is a schizophrenia candidate gene and plays an important role in brain development and neural function. Schizophrenia is a complex disorder, with etiology likely due to epistasis. 

Ссылки
  • Nicodemus KK, et al. (2010) Biological validation of increased schizophrenia risk with NRG1, ERBB4, and AKT1 epistasis via functional neuroimaging in healthy controls. Arch Gen Psychiatry. 67 (10): 991-1001.
  • Tan W, et al. (2007) Molecular cloning of a brain-specific, developmentally regulated neuregulin 1 (NRG1) isoform and identification of a functional promoter variant associated with schizophrenia. J Biol Chem. 282 (33): 24343-51.
  • Holmes WE, et al. (1992) Identification of heregulin, a specific activator of p185erbB2. Science. 256 (5060): 1205-10.
  • Size / Price
    Каталог: HG10658-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».