After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human EIF2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032025.3
Размер кДНК:1758bp
Описание кДНК:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Синоним гена:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10112-ACGRBS16760
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10112-ACRRBS16760
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10112-ANGRBS16760
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10112-ANRRBS16760
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10112-CFRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10112-CHRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10112-CMRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10112-CYRBS14710
Человек eIF2A/eIF2 alpha Джин клон кДНК в вектор клонированияHG10112-MRBS5130
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10112-M-FRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10112-NFRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10112-NHRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10112-NMRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10112-NYRBS14710
Человек eIF2A/eIF2 alpha Джин ORF экспрессии кДНК клона плазмидыHG10112-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10112-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».