Быстрый заказ

Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ZNF558 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005259756.1
    Размер кДНК:996bp
    Описание кДНК:Full length Clone DNA of Homo sapiens zinc finger protein 558.
    Синоним гена:ZNF558
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ZNF558 qPCR primers for gene expression analysis, HP104929 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16160-ACGRBS15400
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16160-ACRRBS15400
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16160-ANGRBS15400
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16160-ANRRBS15400
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16160-CFRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16160-CHRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16160-CMRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16160-CYRBS13340
    Человек ZNF558 Джин клон кДНК в вектор клонированияHG16160-GRBS5130
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16160-NFRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16160-NHRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16160-NMRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16160-NYRBS13340
    Человек ZNF558 Джин ORF экспрессии кДНК клона плазмидыHG16160-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG16160-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».