After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ZNF558 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005259756.1
Размер кДНК:996bp
Описание кДНК:Full length Clone DNA of Homo sapiens zinc finger protein 558.
Синоним гена:ZNF558
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16160-ACGRBS15400
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16160-ACRRBS15400
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16160-ANGRBS15400
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16160-ANRRBS15400
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16160-CFRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16160-CHRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16160-CMRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16160-CYRBS13340
Человек ZNF558 Джин клон кДНК в вектор клонированияHG16160-GRBS5130
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16160-NFRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16160-NHRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16160-NMRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16160-NYRBS13340
Человек ZNF558 Джин ORF экспрессии кДНК клона плазмидыHG16160-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16160-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».