Быстрый заказ

Text Size:AAA

Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human XPR1 Информация о продукте «Клон cDNA»
Размер кДНК:1896bp
Описание кДНК:Full length Clone DNA of Homo sapiens xenotropic and polytropic retrovirus receptor 1 with N terminal HA tag.
Синоним гена:X3, SYG1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15194-ACGRBS16760
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15194-ACRRBS16760
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15194-CFRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15194-CHRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15194-CMRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15194-CYRBS14710
Человек XPR1 Джин клон кДНК в вектор клонированияHG15194-GRBS5130
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15194-NFRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15194-NHRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15194-NMRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15194-NYRBS14710
Человек XPR1 Джин ORF экспрессии кДНК клона плазмидыHG15194-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15194-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.