XPNPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

XPNPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1872 bp
Description
Full length Clone DNA of Human X-prolyl aminopeptidase (aminopeptidase P) 1, soluble with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

XPNPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

APP1 cDNA ORF Clone, Human; SAMP cDNA ORF Clone, Human; XPNPEP cDNA ORF Clone, Human; XPNPEPL cDNA ORF Clone, Human; XPNPEPL1 cDNA ORF Clone, Human

XPNPEP1 Background Information

Full Name
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait