Быстрый заказ

Text Size:AAA

Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human XIAP Информация о продукте «Клон cDNA»
Размер кДНК:1494bp
Описание кДНК:Full length Clone DNA of Homo sapiens X-linked inhibitor of apoptosis with C terminal Myc tag.
Синоним гена:API3, ILP1, MIHA, XLP2, BIRC4
Участок рестрикции:KpnI + XbaI (6kb + 1.54kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human XIAP Gene Plasmid Map
Human XIAP / BIRC4 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10606-ACGRBS15400
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10606-ACRRBS15400
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10606-ANGRBS15400
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10606-ANRRBS15400
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10606-CFRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10606-CHRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10606-CMRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10606-CYRBS13340
Человек XIAP/BIRC4 Джин клон кДНК в вектор клонированияHG10606-MRBS5130
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10606-NFRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10606-NHRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10606-NMRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10606-NYRBS13340
Человек XIAP/BIRC4 Джин ORF экспрессии кДНК клона плазмидыHG10606-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.