Быстрый заказ

Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды

  • Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Человек XCL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002995.1
Размер кДНК:345bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C motif) ligand 1.
Синоним гена:LTN, ATAC, LPTN, SCM1, SCM-1, SCYC1, SCM-1a, XCL1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-XCL1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.35kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with XCL1 qPCR primers for gene expression analysis, HP100639 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек XCL1 Gene Plasmid Map
Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10672-ACGRBS15400
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10672-ACRRBS15400
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10672-CFRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10672-CHRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10672-CMRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10672-CYRBS13340
Человек XCL1 Джин клон кДНК в вектор клонированияHG10672-MRBS5130
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10672-M-FRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10672-NFRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10672-NHRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10672-NMRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10672-NYRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмидыHG10672-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Guzzo C, Fox JC, Miao H, Volkman BF, Lusso P. Structural Determinants for the Selective Anti-HIV-1 Activity of the All-β Alternative Conformer of XCL1. Kirchhoff F, ed. Journal of Virology. 2015;89(17):9061-9067.
  • Size / Price
    Каталог: HG10672-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».