After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human XCL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002995.1
Размер кДНК:345bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C motif) ligand 1.
Синоним гена:LTN, ATAC, LPTN, SCM1, SCM-1, SCYC1, SCM-1a, XCL1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-XCL1
Участок рестрикции:KpnI + XbaI (6.1kb + 0.35kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human XCL1 Gene Plasmid Map
Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10672-ACGRBS15400
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10672-ACRRBS15400
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10672-CFRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10672-CHRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10672-CMRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10672-CYRBS13340
Человек XCL1 Джин клон кДНК в вектор клонированияHG10672-MRBS5130
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10672-M-FRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10672-NFRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10672-NHRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10672-NMRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10672-NYRBS13340
Человек XCL1 Джин ORF экспрессии кДНК клона плазмидыHG10672-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Nguyen KD, et al. (2008) XCL1 enhances regulatory activities of CD4+ CD25(high) CD127(low/-) T cells in human allergic asthma. J Immunol. 181 (8): 5386-95.
  • Dong C, et al. (2005) Glycosylated recombinant human XCL1 / lymphotactin exhibits enhanced biologic activity. J Immunol Methods. 302 (1-2): 136-44.
  • Zavala-Flores LM, et al. (2009) Production of biologically active human lymphotactin (XCL1) by Lactococcus lactis. Biotechnol Lett. 31 (2): 215-20.
  • Size / Price
    Каталог: HG10672-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human XCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».