Быстрый заказ

Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек XBP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005080.3
    Размер кДНК:786bp
    Описание кДНК:Full length Clone DNA of Homo sapiens X-box binding protein 1 with N terminal His tag.
    Синоним гена:XBP2, TREB5, XBP1
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with XBP1 qPCR primers for gene expression analysis, HP100896 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10751-ACGRBS15400
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10751-ACRRBS15400
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10751-ANGRBS15400
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10751-ANRRBS15400
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10751-CFRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10751-CHRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10751-CMRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10751-CYRBS13340
    Человек XBP1 Джин клон кДНК в вектор клонированияHG10751-MRBS5130
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10751-M-FRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10751-NFRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10751-NHRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10751-NMRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10751-NYRBS13340
    Человек XBP1 Джин ORF экспрессии кДНК клона плазмидыHG10751-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».