After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек WTAP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human WTAP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_152857
Размер кДНК:1191bp
Описание кДНК:Full length Clone DNA of Homo sapiens Wilms tumor 1 associated protein.
Синоним гена:KIAA0105, MGC3925
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-WTAP
Участок рестрикции:KpnI + XbaI (6.1kb + 1.19kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human WTAP Gene Plasmid Map
Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12018-ACGRBS15400
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12018-ACRRBS15400
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12018-ANGRBS15400
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12018-ANRRBS15400
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12018-CFRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12018-CHRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12018-CMRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12018-CYRBS13340
Человек WTAP Джин клон кДНК в вектор клонированияHG12018-GRBS5130
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12018-G-FRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12018-NFRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12018-NHRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12018-NMRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12018-NYRBS13340
Человек WTAP Джин ORF экспрессии кДНК клона плазмидыHG12018-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

Ссылки
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    Каталог: HG12018-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human WTAP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».