WNT16 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

WNT16 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human wingless-type MMTV integration site family, member 16 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.14kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WNT16 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WNT16 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

WNT16 Background Information

Wnt family member 16 (WNT16) is a major Wnt ligand involved in the regulation of postnatal bone homeostasis. WNT16 plays a critical role for acquisition of both cortical and trabecular bone mass and strength. WNT16-targeted therapies might be useful for treatment of postmenopausal trabecular bone loss.
Full Name
wingless-type MMTV integration site family, member 16
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait